Deletions into an NH2-Terminal Hydrophobic Domain in Secretion of Rotavirus VP7, a Resident Endoplasmic Reticulum Membrane Glycoprotein Result

Rotavirus, a non-enveloped reovirus, buds into the rough endoplasmic reticulum and transiently acquires a membrane. The structural glycoprotein, VP7, a 38-kD integral membrane protein of the endoplasmic reticulum (ER), presumably transfers to vi.rus in this process. The gene for VP7 potentially encodes a protein of 326 amino acids which has two tandem hydrophobic domains at the NH2-terminal, each preceded by an in-frame ATG codon. A series of deletion mutants constructed from a full-length cDNA clone of the Simian 11 rotavirus VP7 gene were expressed in COS 7 cells. Products from wild-type, and mutants which did not affect the second hydrophobic domain of VP7, were localized by immunofluorescence to elements of the ER only. However, deletions affecting the second hydrophobic domain (mutants 42-61, 43-61, 47-61) showed immunofluorescent localization of.VP7 which coincided with that of wheat germ agglutinin, indicating transport to the Golgi apparatus. Immunoprecipitable wild-type protein, or an altered protein lacking the first hydrophobic sequence, remained intracellular and endo-~-N-acetylglucosaminidase H sensitive. In contrast, products of mutants 42-61, 43-61, and 47-61 were transported from the ER, and secreted. Glycosylation of the secreted molecules was inhibited by tunicamycin, resistant to endo-~-Nacetylglucosaminidase H digestion and therefore of the N-linked complex type. An unglycosylated version of VP7 was also secreted. We suggest that the second hydrophobic domain contributes to a positive signal for ER location and a membrane anchor function. Secretion of the mutant glycoprotein implies that transport can be constitutive with the destination being dictated by an overriding compartmentalization signal. The targeting and sorting of membrane proteins to their different subcellular compartments has become a major topic of interest in cell biology and a problem that has become increasingly amenable to manipulation by gene cloning techniques. Membrane maturing viruses have long been used to probe questions of this nature (22) because of the high abundance of the membrane proteins of interest in infected cells. Several laboratories have used the cloned genes of membrane glycoproteins, such as influenza hemagglutinin (1 l, 17, 35, 38), vesicular stomatitis virus G protein (15, 19, 34), Semliki forest virus (16, 23), and robs sarcoma virus (45) to probe for TIlE JOURNAL OF CELL BIOLOGY VOLUME 101 DECEMBER 1985 2199-2209 © The Rockefeller University Press . 0021-9525/8511212199/11 $1.00 the portions of the expressed products that are important in determining their plasma membrane localization. These membrane glycoproteins are characterized by a COOH-terminal hydrophobic membrane anchoring segment and a cytoplasmic tail. Disruption of the former has generally resulted in complete secretion of these molecules, which in their native state traverse most of the secretory pathway. Alterations of the COOH-terminal cytoplasmic tail had diverse effects. Some mutant proteins became blocked along the secretory pathway and others failed to traverse the pathway at all. The exact nature of the signal for targeting these proteins to the plasma 2199 on July 8, 2017 jcb.rress.org D ow nladed fom membrane was not clear from these studies. Failure of these molecules to move along the exocytosis pathway may have been due to the alteration of a positive plasma membrane targeting signal or to denaturation of the protein product. Rotavirus VP7 is a glycoprotein of particular interest as a potential model for the study of protein transport (21). This protein associates with viral cores that bud into the lumen of the rough endoplasmic reticulum (RER) j (1) from cytoplasmic structures, called viroplasms. Mature virus remains within the lumen of the RER until release by cell lysis. VP7 is an integral membrane glycoprotein with a lumenal orientation (21) and is located in the endoplasmic reticulum (ER) (10, 32). The Golgi apparatus is not involved in processing the mature form of VPT, a fact confirmed by the presence on the molecule of the high-mannose form of carbohydrate (9). VP7 therefore constitutes an example of a membrane glycoprotein that is targeted to the ER and is not subsequently directed further along the secretory pathway. The cloning and sequencing of the SA 11 VP7 gene revealed the presence of two tandem NH2-terminal hydrophobic domains in the protein, and the absence of a COOH-terminal hydrophobic domain (7). Each of the hydrophobic domains is preceded by an AUG codon and could ostensibly serve as a signal peptide for the translocation of VP7, depending on which codon is read for initiation. However, the specific role of each of these codons and hydrophobic segments in VP7 synthesis is not clear. In studying the function of the hydrophobic domains, we constructed a series of deletions in the VP7 gene. Three mutants were obtained for which the VP7 proteins acquired complex carbohydrate, as distinct from the high-mannose type exhibited by wild-type VP7, showing that they traversed the secretory pathway and reached the Golgi apparatus. These proteins were also secreted. A priori, the transport of VP7 to more distal locations along the secretory route should require either the modification of a positive signal specifying ER location, or alternatively, the addition of a signal enabling vectorial transport to occur. The induction of VP7 secretion by creating various deletions in the protein is more easily explained by the disruption of a positive signal specifying ER location. We conclude that there must be a positive signal for retention of a protein in the ER. Since wild-type VP7 is naive to the secretory pathway, it is also implied that in the absence of overriding sorting signals, secretion is constitutive. MATERIALS AND METHODS cDNA Cloning and Construction of a Plasmid for VP7 Expression: Standard molecular cloning techniques were used in this work (29). The complete sequence of genomic segment nine of Simian 11 rotavirus was obtained previously using a partial length cDNA clone that lacked 5'terminal sequences (7). A full-length clone was isolated using a modified cloning strategy (20). This yielded a VP7 clone inserted in the Pst I site of pBR322 which was confirmed as full length by terminal sequence analysis (30). The insert was excised with Pst I, digested with nuclease Bal 31 to remove G:C homopolymer tails, and the blunt-ended molecule was flanked with Xho I sites by the addition of phosphorylated Xho I linkers (P-L Bioehemicals). The VP7 gene with Xho I termini was then inserted into the unique Xho I site of pJC 119 (36) to yield plasmid pJC16 which contained the rotavirus VP7 sequence in the correct orientation downstream from the SV40 late promoter, pJC119 was obtained from by Dr. J. Condra, Division of Virus and Cell Biology Research, Merck, Sharp & Dohme Research Laboratories, West Point, PA. Sequencing Abbreviations used in this paper: DME, Dulbecco's modified Eagle's medium; endo-H, endo-~-N-acetylglucosaminidase H; ER, endoplasmic reticulum; PAS, protein A-conjugated Sepharose CL4B; RER, rough endoplasmic reticulum; R-WGA, wheat germ agglutinin conjugated to rhodamine. 2200 THE JOURNAL OF CELL BIOLOGY , VOLUME 101, 1985 revealed that pJC 16 nevertheless contained residual homopolymeric sequences (15G residues) at the 5'-end of the gene. These were removed by replacing the 5'-terminal region of the clone proximal to the Nco I site with a fragment that lacked the residual homopolymeric tail. An Aha llI-Nco I fragment was prepared from the SAIl VP7 clone, Xho I linkers were added to the Aha III end, and after recutting, the Xho l-Nco I fragment was cloned into the SV40 vector to generate the plasmid pJC9 (Fig. 1). Preparation of Deletion Mutants of VP7: pJC9 was cut with Bam HI and the 387-bp 5'-terminal fragment of the VP7 gene (Fig. 1) was subcloned into the Barn HI site of pBR322 to generate pBR9B (Fig. 1) which contains a unique Nco I site. The plasmid was made linear by cutting with Nco I and digested with Bal 31 to remove nucleotides progressively. The products were made blunt ended, Nco I linkers (a generous gift of Dr. R. Gregson, Biotechnology Australia, Proprietary Ltd., Roseville, NSW) were added and the plasmids were religated to generate a series of deleted variants of pBR9B. These were sequenced from the Nco I site in order to identify those carrying appropriate in-frame deletions. The small Xho I/Nco I fragments containing modified 5'-regions of the gene were retrieved and incorporated into the expression vector (pJC9) by a three-way ligation as outlined in Fig. I. Another mutant (I-14), which deleted the first ATG and therefore the first hydrophobic domain, was prepared as follows. Xho I linkers were added to an Eco RV/Bam HI fragment (Figs. 1 and 2). This fragment was cut with Xho 1 and Nco I and the smaller Xho I/Nco I fragment isolated. This segment was then reincorporated into pJC9 by the three-way ligation method described above. Mutant 2-8 was constructed as follows. The oligonucleotides 5' CATGGTTCTAACCTTTCTGATAT 3' and 5"CGATATCAGAAAGGTTAGAAC 3' were made using a DNA synthesizer (Applied Biosystems, Inc., Foster City, CA). These are complementary and create Nco Iand Cla Icompatible termini when annealed. The oligonucleotides were phosphorylated and ligated with the EcoR1/Xho 1 fragment from pJC9 (Fig. 1 ) and a fragment from the same plasmid, which extended through the VP7 gene, counterclockwise from the EcoR I site to the Cla I site near the 5'-end of the gene (7). The fourth fragment which permitted the vector to circularize was an Xho 1/Nco I fragment of 53 bases derived from a pBR9B deletion mutant (Fig. 1 ), where the Bal 31 digestion went precisely to the first ATG codon. This construction deleted the first eight amino acids of VP7 which are conserved between human, simian, and bovine rotaviruses, and substituted Met-Ala-Met such that the final NH2-terminal sequence now reads as Met-Ala-Met-Val-Leu-Thr . . . . . . . Polyclonal Anti-VP7 Antiserum: SAIl rotavirus was propagated and purified by published procedures (37). Intact double-shelled virions labeled with 1251 (26) were concentrated by ultracentrifugation and disrupted by boiling in an SDS dissociation buffer containing 2-mercaptoethanol (25). Viral polypeptides were resolved by electrophoresis on discontinuous slab gels (25) and the band corresponding to VP7 located by radioautography. The region of the gel containing the SDS-denatured VP7 was recovered, homogenized with incomplete Freund's adjuvant, and injected subcutaneously into rabbits. Animals were boosted at 4-wk intevals and the antiserum confirmed as monospecific by Western blot analysis (42). Cell Growth, Transfection, Tunicamycin Treatment, and Radiolabeling: The RRI strain of Escherichia coli was used for the propagation of all plasmid DNA used for transfections. After standard bacterial lysis procedures (29), DNA was isolated and purified by cesium chlorideethidium bromide ultracentrifugation followed by precipitation and resuspension in water. The procedure for transfection of COS 7 cells (18) follows that of published procedures (34) with several modifications. COS 7 cells were grown on 100-mm dishes in Dulbecco's modified Eagle's medium (DME) (Gibco Laboratories, Grand Island, NY), containing 5% each of calf and fetal calf serum, 100 U/ml penicillin, 100 ~g/ml streptomycin (Gibco Laboratories) and 2 mM L-glutamine. Monolayers that were 60-80% confluent were washed and transfected in Tris-buffered saline (19). DNA (l 5-30 ~g/ml) was added to each plate followed by the addition of DEAE-dextran (Pharmacia Fine Chemicals, Piscataway, NJ; 2 × l06 daltons; 500 ug/ml) (19). After 1.5-2 h at 37"C, the Tris-buffered saline solution was removed and DME, containing serum as above and 100 uM chloroquine (Sigma Chemical Co., St. Louis, MO), was added to the cells. After incubation for 3 h at 37"C, DME without chloroquine but containing serum and additions as above was added. At 45 h after DNA/ DEAE-dextran removal, the cells were incubated at 37"C for l h in DME salts lacking serum and methionine but supplemented with all other amino acids and l mg/ml glucose. Transfected cells were then labeled for 2.5 or 4 h at 37"C on a rocker platform in the above medium to which L-[35Slmethionine at a concentration of 150 uCi/ml was added. At the end of the labeling period, the medium was collected and non-adherent cells were pelleted by centrifugation in an Eppendorf centrifuge for l0 min. Supernatants were removed and analyzed for expressed secreted material. For those cells treated with tunicamycin, dishes were incubated in medium containing tunicamycin (Sigma Chemical Co.), at a final concentration of 2 on July 8, 2017 jcb.rress.org D ow nladed fom